It turns out that it doesn't really matter when I freeze the sample, I can get high-quality RNA either way:
All 6 of my samples came out with really high RIN numbers. Talking with J~, it seems that the best way to go is to freeze the sample after the phenol-chloroform separation stage. At this point the RNA is pretty clean, certainly more so than in the RNAsolv buffer and I haven't used any of the columns or anything. Further, we're unclear of how the phenol-based RNAsolv buffer holds up for long-term freezing (this was only frozen for 2 days), whereas the top separated layer should remain stable frozen indefinitely.
Now, on to my samples!
Thursday, December 13, 2012
Monday, December 10, 2012
RNA/Sample storage experiment
Before I launch into extracting the remaining 28 placentas, J~ wants me to run through a quick experiment:
The RNAextraction kit that I'm using (this probably holds for most RNA kits actually) calls for a small amount of tissue (15-50mg). As I am extracting placenta which routinely weigh up to 500mg (0.5g) I have a ton of extra tissue. I have an issue though, as placentas are highly complex: composed of at least 3 different cell types arranged in layers. This means that I cannot just cut off a small bit of placenta and use that (it isn't a random sample of the entire tissue - maybe I would end up with just 1 layer etc...). Instead I have to homogenize the entire sample first (normally with liquid Nitrogen) and then use part of the homogenized tissue. This sucks because if I mess something up, I ruin the entire sample.
Aside from the risk of ruining my samples, it sounds pretty straightforward. But it's not. Once a tissue is homogenized it has a much higher risk of RNA degradation (all the RNAses have been released from their cellular confines) and cannot just be put back in the freezer. Instead I add it to the first buffer of the RNA kit - in this case it's called "RNAsolv." The volume of buffer depends on the weight of the tissue (in this kit it's 1ml/30mg) so with a 500mg placenta, I will end up with 500mg*1ml/30mg=~17ml of placenta-buffer slurry and I only need 1ml of buffer (30mg of tissue). Therefore I am left with obscene quantities of blueish-brown placenta slurry.
The question is: can we do anything with this slurry? And more specifically: is there any way to keep some of this around so that if I do mess up an RNA extraction, I can go back to the slurry mixture and just re-extract RNA instead of loosing the sample entirely?
To test this I will work through the extraction and at periodic points, freeze some of the sample, then in a couple days, thaw it out and finish the extraction. Here's an outline of the experiment:
This way I have 3 treatments: (1) "never frozen", (2) "top layer frozen" (freeze the liquid layer of the Phenol-Chloroform extraction), and (3) "buffer frozen" (freeze the RNAsolv - phenol - buffer right away). Each Treatment will be duplicated to get a sense of the variance.
I have just finished the extraction from #1 and I will finish up #2 and #3 on Wednesday. Then they can go on the bioanalyzer and we'll see if it works.
And, just because concentration is so important, here are the nano-drop values from these samples:
Never froze 1: 487ng/ul
Never froze 2: 546ng/ul
Top layer froze 1: 564ng/ul
Top layer froze 2: 530ng/ul
Buffer froze 1: 570ng/ul
Buffer froze 2: 549ng/ul
The RNAextraction kit that I'm using (this probably holds for most RNA kits actually) calls for a small amount of tissue (15-50mg). As I am extracting placenta which routinely weigh up to 500mg (0.5g) I have a ton of extra tissue. I have an issue though, as placentas are highly complex: composed of at least 3 different cell types arranged in layers. This means that I cannot just cut off a small bit of placenta and use that (it isn't a random sample of the entire tissue - maybe I would end up with just 1 layer etc...). Instead I have to homogenize the entire sample first (normally with liquid Nitrogen) and then use part of the homogenized tissue. This sucks because if I mess something up, I ruin the entire sample.
Aside from the risk of ruining my samples, it sounds pretty straightforward. But it's not. Once a tissue is homogenized it has a much higher risk of RNA degradation (all the RNAses have been released from their cellular confines) and cannot just be put back in the freezer. Instead I add it to the first buffer of the RNA kit - in this case it's called "RNAsolv." The volume of buffer depends on the weight of the tissue (in this kit it's 1ml/30mg) so with a 500mg placenta, I will end up with 500mg*1ml/30mg=~17ml of placenta-buffer slurry and I only need 1ml of buffer (30mg of tissue). Therefore I am left with obscene quantities of blueish-brown placenta slurry.
The question is: can we do anything with this slurry? And more specifically: is there any way to keep some of this around so that if I do mess up an RNA extraction, I can go back to the slurry mixture and just re-extract RNA instead of loosing the sample entirely?
To test this I will work through the extraction and at periodic points, freeze some of the sample, then in a couple days, thaw it out and finish the extraction. Here's an outline of the experiment:
This way I have 3 treatments: (1) "never frozen", (2) "top layer frozen" (freeze the liquid layer of the Phenol-Chloroform extraction), and (3) "buffer frozen" (freeze the RNAsolv - phenol - buffer right away). Each Treatment will be duplicated to get a sense of the variance.
I have just finished the extraction from #1 and I will finish up #2 and #3 on Wednesday. Then they can go on the bioanalyzer and we'll see if it works.
And, just because concentration is so important, here are the nano-drop values from these samples:
Never froze 1: 487ng/ul
Never froze 2: 546ng/ul
Top layer froze 1: 564ng/ul
Top layer froze 2: 530ng/ul
Buffer froze 1: 570ng/ul
Buffer froze 2: 549ng/ul
Friday, December 7, 2012
RNA extractions and the Bioanalyzer III: the solution
I finally figured it out. Naturally it was one of those mistakes that are considered "dumb" in hindsight, but it sure caused a ton of stress at the time. The problem was that I was not diluting my samples enough when I put them on the bioanalyzer. It's nothing to do with ethanol or chloroform or any of the other variables I spent the last couple months testing. I have been doing RNA extractions just fine the entire time, and then fucking up the quality assay.
Below you can see the differences. On the left there are two samples that I ran on October 1st. The desired concentration is between 200 and 5,000pg/ul and these were at a concentration of 92,448pg/ul and 54,308pg/ul. I diluted them down to the proper concentration and re-ran them yesterday (right column) and they turned out really great (RIN>8 is acceptably good, >9 is perfect).
Below you can see the differences. On the left there are two samples that I ran on October 1st. The desired concentration is between 200 and 5,000pg/ul and these were at a concentration of 92,448pg/ul and 54,308pg/ul. I diluted them down to the proper concentration and re-ran them yesterday (right column) and they turned out really great (RIN>8 is acceptably good, >9 is perfect).
So, what have I learned? The bioanalyzer is incredibly accurate in it's small range of acceptable concentrations, once you get outside of that range the quality goes way down. The nanodrop is mildly accurate, but can handle a huge range of concentrations. The first step is always to use the nanodrop to get a good idea of the starting concentration of a sample, then dilute the samples to fall within the range of high accuracy of the bioanalyzer.
There are actually two types of chips for analyzing RNA with the Bioanalyzer: "Nano chips" and "Pico chips." The differences is the concentration they deal well with. Here's a picture:
Green = Nanodrop
Red = Bioanalyzer Pico chip (20-5000pg/ul)
Blue = Bioanalyzer Nano chip (5-500ng/ul)
It turns out that if I had been using the Nano chips, my RNA probably would have fallen perfectly within the range. That would have saved a bunch of time, heartache, and money, but on the other hand I wouldn't have learned the concentration lesson in such a lasting and exquisitely painful manner.
I now have nano chips which I will be using for my samples and I am going to run the rest of my samples to see whether I ruined them (as I had thought before) or they are actually usable (which it looks like they probably are). Most importantly for my personal self-confidence though, this means that my molecular technique is just fine, it was my understanding of the machines I was using that fell short. A deficit in knowledge is easier to correct and not such a blow to the ego.
Sunday, December 2, 2012
RNA extractions and bioanalyzer results II
I have done a couple trials of RNA extractions to figure out what is going wrong (see my last post on rna extractions).
All these were done using liver tissue which had been dissected and snap frozen on dry ice:
I extracted the first two and the results were not great, so I talked with J~ and realized some mistakes (too much tissue, no Beta mercaptoethanol, undergrads using my pipettes...). Then I did the next three rows to correct for those possible errors. I also changed how I'm washing the mortars and pestels: use bleach, then rinse with molecular grade water, use RNase-away and rinse with molecular grade water, then cover with tin foil and dry at 95c, and cool before use.
I won't post the entire bioanalyzer results, but here is a summary of the results:
I also did an experiment where S~ and I each extracted RNA side-by-side to make sure that I wasn't missing a step or doing anything else weird. S~ didn't notice anything, but the results (both hers and mine) were well below 8.
As everything up to this point was only mildly successful if that (none above RIN=8), I decided to do a comparison between completely fresh tissue and that same tissue that had been frozen. I sacrificed an animal and divided the liver into two parts - on went straight on dry ice and the other went directly to the extraction. The one on ice remained there until I finished the first extraction ~1.5hours.
I also realized that I have a second protocol that doesn't require the use of columns at all (it just uses the RNAsolv reagent), so I decided to run these next to each other. I followed the same protocol as above in regard to fresh and frozen tissue. The RNAsolv method ended up with 4 tubes per treatment. I only ran 2 of each on the bioanalyzer.
Results:

The two RNAsolv with fresh tissue didn't work at all and the other two were quite poor. I won't be using that protocol again. As for the Fresh vs Frozen tissue with the kit, it looks like frozen is actually better, though the difference is small. At least I have gotten two 8's though, that's looking up.
Not really sure what to do next. Committee members have said to just keep going until it's right, regardless of how long it takes. But I don't have anything to change, and furthermore I don't feel like I've done anything different even between the earlier 6.6 and this recent 8. The lab tech has said that she didn't realize that she was doing anything different when she suddenly started getting high RINs though so maybe there is still hope for me.
In unrelated news, it turns out that placenta has one of the highest incidences of RNases (along with pancreas). That doesn't explain poor quality liver RNA of course, but is something for me to keep in mind when extracting my placentas in the future...
All these were done using liver tissue which had been dissected and snap frozen on dry ice:
I extracted the first two and the results were not great, so I talked with J~ and realized some mistakes (too much tissue, no Beta mercaptoethanol, undergrads using my pipettes...). Then I did the next three rows to correct for those possible errors. I also changed how I'm washing the mortars and pestels: use bleach, then rinse with molecular grade water, use RNase-away and rinse with molecular grade water, then cover with tin foil and dry at 95c, and cool before use.
I won't post the entire bioanalyzer results, but here is a summary of the results:

I also did an experiment where S~ and I each extracted RNA side-by-side to make sure that I wasn't missing a step or doing anything else weird. S~ didn't notice anything, but the results (both hers and mine) were well below 8.
I also realized that I have a second protocol that doesn't require the use of columns at all (it just uses the RNAsolv reagent), so I decided to run these next to each other. I followed the same protocol as above in regard to fresh and frozen tissue. The RNAsolv method ended up with 4 tubes per treatment. I only ran 2 of each on the bioanalyzer.
Results:

The two RNAsolv with fresh tissue didn't work at all and the other two were quite poor. I won't be using that protocol again. As for the Fresh vs Frozen tissue with the kit, it looks like frozen is actually better, though the difference is small. At least I have gotten two 8's though, that's looking up.
Not really sure what to do next. Committee members have said to just keep going until it's right, regardless of how long it takes. But I don't have anything to change, and furthermore I don't feel like I've done anything different even between the earlier 6.6 and this recent 8. The lab tech has said that she didn't realize that she was doing anything different when she suddenly started getting high RINs though so maybe there is still hope for me.
In unrelated news, it turns out that placenta has one of the highest incidences of RNases (along with pancreas). That doesn't explain poor quality liver RNA of course, but is something for me to keep in mind when extracting my placentas in the future...
Tuesday, October 16, 2012
Radio Interview
Here's a radio interview that I gave recently for the University's radio station KBGA. On air Tuesday October 16, 2012 from 5-6pm.
Monday, October 15, 2012
RNA extractions and bioanalyzer results
I bioanalyzed the "test" RNA placenta sample and it turned out to be slightly degraded: the RNA Integrity Number (RIN) was 7.8 (should be ~10).
The two tall peaks at 2000 and 4000 are the ribosomal RNA, the small one at ~180 is the marker. The RIN is a measure of quality, essentially it's a ratio between the two ribosomal peaks. The second one (4000) should be much taller than the first, otherwise there has been some degradation that occured and the sample is no good. In this sample, the second is indeed taller than the first, but not enough. I actually think it's calculated by area under the curve rather than height, but close enough. Another sign of bad RNA is the ripples in between the two peaks - it should be fairly smooth, when it's rough, that's a sign of degradation.
In all, I was kind of expecting this as the sample thawed briefly before I got it in the buffer. As in the last post, I realized this and planned around it for the next time. Then, mistakenly, I assumed that I should go ahead and start on my samples. I extracted 12 (of 40) and bioanalyzed the first 5:
Each sample here has 2 charts, the first is the totalRNA, the second is the miRNA. There will be no ribosomes in the miRNA, so we have no way of gauging quality with those, but as for the others, they were all pretty awful. No RIN was above 7.3 and most didn't have even an estimate. Clearly there is some degradation although that's not the only thing going on - numbers 7 and 9 both have a weird hump early in the read before establishing the baseline and 6 and 8 have a hump near the end. Neither of these things should happen. This also sucks because they were my important precious samples. I do have back ups for them all so it's not a huge deal, but it's scary as I definitely ruined them and I need to not do this again.
The next step is to bioanalyze the other samples that I've extracted already.
After that I need to figure out what is going wrong:
I will first do another extraction (liver this time - placentas are too valuable) comparing my kit (Omega) with another brand (Qiagen) that we have in the lab and we know works.
The two tall peaks at 2000 and 4000 are the ribosomal RNA, the small one at ~180 is the marker. The RIN is a measure of quality, essentially it's a ratio between the two ribosomal peaks. The second one (4000) should be much taller than the first, otherwise there has been some degradation that occured and the sample is no good. In this sample, the second is indeed taller than the first, but not enough. I actually think it's calculated by area under the curve rather than height, but close enough. Another sign of bad RNA is the ripples in between the two peaks - it should be fairly smooth, when it's rough, that's a sign of degradation.
In all, I was kind of expecting this as the sample thawed briefly before I got it in the buffer. As in the last post, I realized this and planned around it for the next time. Then, mistakenly, I assumed that I should go ahead and start on my samples. I extracted 12 (of 40) and bioanalyzed the first 5:
Each sample here has 2 charts, the first is the totalRNA, the second is the miRNA. There will be no ribosomes in the miRNA, so we have no way of gauging quality with those, but as for the others, they were all pretty awful. No RIN was above 7.3 and most didn't have even an estimate. Clearly there is some degradation although that's not the only thing going on - numbers 7 and 9 both have a weird hump early in the read before establishing the baseline and 6 and 8 have a hump near the end. Neither of these things should happen. This also sucks because they were my important precious samples. I do have back ups for them all so it's not a huge deal, but it's scary as I definitely ruined them and I need to not do this again.
The next step is to bioanalyze the other samples that I've extracted already.
After that I need to figure out what is going wrong:
I will first do another extraction (liver this time - placentas are too valuable) comparing my kit (Omega) with another brand (Qiagen) that we have in the lab and we know works.
- If both come out bad then it's my fault and I need to do better with my technique (Yikes, I really hope it's not this one...)
- If the Qiagen one is bad and not the Omega, then it's an issue with the kit, and we need to get a new kit (or make new buffers).
Another potential issue is that I used standard alcohol when preparing my buffers not realizing that molecular grade ethanol exists. I will be using molecular grade in the future on of course, but in order to avoid confounding variables in the above experiment I will do everything exactly the same for the Omega extraction as I had before. Afterwards, I will do second test will be to use molecular grade ethanol alongside regular ethanol to determine whether the ethanol is the problem.
Friday, September 28, 2012
RNA extractions
I started the RNA extractions yesterday. I am using an Omega EZNA miRNA Kit and including the "optional" on-column DNase treatment. I'm planning to sequence almost every molecule in these so I want to make sure that I don't have any DNA contamination. The first sample I did was a throw-away sample to work through any bugs. Which was good cause there were a couple.
The first main problem I had was after I ground the tissue on liquid Nitrogen, I had to measure out 30-50mg, and the sample thawed. In the end my RNA Integrity Number (RIN) off the bioanalyzer was 7.8 (the higher the better - I'm shooting for 10, we may consider sequencing a sample that is as low as 9). I am pretty sure that the brief thaw was the issue there.
The second problem I had was that it calls for a 10 minutes spin at 4c and I don't have a centrifuge that refrigerates. I did the spin at RT and later found out that the lab next door has a centrifuge that will keep it at 4c. This may have also been part of the issue with the low RIN.
For the samples today, I used a different method to avoid thawing the sample during weighing. First: 1ml of buffer can handle 30-50m of tissue. I know the weight of each tissue so I pre-allocated out enough buffer so that I have 50mg of tissue for each 1ml of buffer. I'm going to have to buy more buffer to be able to finish the kit, but that's not a huge deal. Second, each column will handle up to 100mg of tissue which means I will use 2ml of buffer to go on each column. This way, every time I finished grinding a placenta, the powder went straight into the pre-measured buffer without ever thawing, then I used 2ml of the buffer - often having plenty left over (especially for the overgrown crosses).
The next issue is that the powder is so cold that it will freeze the buffer. Once the buffer freezes, it forms a shell around the powder and since it is water-based it has a much higher specific heat than the powder. This means that the buffer shell will stay frozen as the powder inside thaws and degrades. This is a huge issue and the first 5 extractions (I've done 8 so far out of 40) may all be prone to this degradation issue. To circumvent this one I am dumping the powder into the buffer instead of the buffer into the frozen powder tube. It helps a lot, but still isn't 100%. I'm going to run the bioanalyzer tomorrow morning to check them out and see how degraded everything is - hopefully not at all.
The miRNA kits are interesting. There are two separate columns: one for tRNA (the "t" here stands for "total" not for "transport"), and one for miRNA (micro RNA). You run everything through the tRNA column and then take the flow-through and put that onto the miRNA column. Then they tell you to put the tRNA in the fridge and finish purifying the miRNA before going back to finish the tRNA purification. This may make sense if you are more worried about the miRNA, but I really want the tRNA, the miRNA is really just an afterthought - we're not even sure what experiment to do with it, we just thought it might be nice to have in case we think of anything... suggestions are more than welcome. But I wonder if another reason the RIN score was so low for the first sample was because I set the tRNA in the fridge for 30 minutes while I finished the miRNA section. It may be a better idea to put the miRNA one in the fridge and do the tRNA one first. I'm going to have to talk to J~ about this once I run the others through the bioanalyzer and see their RIN numbers.
The first main problem I had was after I ground the tissue on liquid Nitrogen, I had to measure out 30-50mg, and the sample thawed. In the end my RNA Integrity Number (RIN) off the bioanalyzer was 7.8 (the higher the better - I'm shooting for 10, we may consider sequencing a sample that is as low as 9). I am pretty sure that the brief thaw was the issue there.
The second problem I had was that it calls for a 10 minutes spin at 4c and I don't have a centrifuge that refrigerates. I did the spin at RT and later found out that the lab next door has a centrifuge that will keep it at 4c. This may have also been part of the issue with the low RIN.
For the samples today, I used a different method to avoid thawing the sample during weighing. First: 1ml of buffer can handle 30-50m of tissue. I know the weight of each tissue so I pre-allocated out enough buffer so that I have 50mg of tissue for each 1ml of buffer. I'm going to have to buy more buffer to be able to finish the kit, but that's not a huge deal. Second, each column will handle up to 100mg of tissue which means I will use 2ml of buffer to go on each column. This way, every time I finished grinding a placenta, the powder went straight into the pre-measured buffer without ever thawing, then I used 2ml of the buffer - often having plenty left over (especially for the overgrown crosses).
The next issue is that the powder is so cold that it will freeze the buffer. Once the buffer freezes, it forms a shell around the powder and since it is water-based it has a much higher specific heat than the powder. This means that the buffer shell will stay frozen as the powder inside thaws and degrades. This is a huge issue and the first 5 extractions (I've done 8 so far out of 40) may all be prone to this degradation issue. To circumvent this one I am dumping the powder into the buffer instead of the buffer into the frozen powder tube. It helps a lot, but still isn't 100%. I'm going to run the bioanalyzer tomorrow morning to check them out and see how degraded everything is - hopefully not at all.
The miRNA kits are interesting. There are two separate columns: one for tRNA (the "t" here stands for "total" not for "transport"), and one for miRNA (micro RNA). You run everything through the tRNA column and then take the flow-through and put that onto the miRNA column. Then they tell you to put the tRNA in the fridge and finish purifying the miRNA before going back to finish the tRNA purification. This may make sense if you are more worried about the miRNA, but I really want the tRNA, the miRNA is really just an afterthought - we're not even sure what experiment to do with it, we just thought it might be nice to have in case we think of anything... suggestions are more than welcome. But I wonder if another reason the RIN score was so low for the first sample was because I set the tRNA in the fridge for 30 minutes while I finished the miRNA section. It may be a better idea to put the miRNA one in the fridge and do the tRNA one first. I'm going to have to talk to J~ about this once I run the others through the bioanalyzer and see their RIN numbers.
Monday, September 17, 2012
Experimental Design - Replicate, Randomize, Block
The design I had set up in the last post is no good. The problem is that I am confounding technical replicates and biological replicates and have no way to tease them apart: each lane includes biological replicates, but not technical ones, so I have no idea if a difference between the lanes is due to biology or to technical differences with the sequencing.
Here is my new solution.
I have 8 treatments:
P. campbelli male (BBM)
P. campbelli female (BBF)
P. campbelli X P. sungorus male (BSM)
P. campbelli X P. sungorus female (BSF)
P. sungorus X P. campbelli male (SBM)
P. sungorus X P. campbelli female (SBF)
P. sungorus male (SSM)
P. sungorus female (SSF)
Each of these has 5 biological replicates (#1-5)
I will use 2 lanes and I have 24 barcodes.
So, after going over the Auer (2010) paper again, here is the new set up:
Lane 1: Lane 2:
BBM1+2+3 BBM3+4+5
BBF1+2+3 BBF3+4+5
BSM1+2+3 BSM3+4+5
BSF1+2+3 BSF3+4+5
SBM1+2+3 SBM3+4+5
SBF1+2+3 SBF3+4+5
SSM1+2+3 SSM3+4+5
SSF1+2+3 SSF3+4+5
This is 24 individuals per lane, meaning I have enough barcodes. And, most importantly, there is a technical replicate for each treatment --> Biological Replicate #3 appears in both lanes. This way I can test for differences between the lanes (technical replicates) and ascribe those differences to the sequencing platform while still parsing out the biological variance as well.
Auer, P. L. and R. W. Doerge. 2010. Statistical Design and Analysis of RNA Sequencing Data. Genetics 185:405–416.
Saturday, September 15, 2012
Samples for RNAseq
One of the problems with past RNAseq studies of imprinting (such as the two Gregg (2010) science papers, see Proudhon (2011), and DeVeal (2012)) was an inadequate sample size and incorrect experimental set-up. This led to a large number of false-positives. To avoid these mistakes I am going to use 40 samples, 10 from each genotype (5 from each sex). Here is the set up:
P. campbelli 5 female, 5 male
P. campbelli X P. sungorus 5 female, 5 male
P. sungorus X P. campbelli 5 female, 5 male
P. sungorus 5 female, 5 male
I will be able to sequence 20 samples per lane, meaning that I can't split it perfectly equally between the lanes. In order to avoid batch effects (Auer, 2010), I will use the following set up:
Lane 1:
P. campbelli 3 female, 2 male
P. campbelli X P. sungorus 3 female, 2 male
P. sungorus X P. campbelli 3 female, 2 male
P. sungorus 3 female, 2 male
Lane 2:
P. campbelli 2 female, 3 male
P. campbelli X P. sungorus 2 female, 3 male
P. sungorus X P. campbelli 2 female, 3 male
P. sungorus 2 female, 3 male
Finally, each of the 5 female and 5 male placentas will be brother-sister pairs, from 5 different litters (this is the ideal, I'll have to do some more sex-typing to see if I can actually make it work - stay tuned. I will definitely assure that the 5 females are from 5 different litters (and the same for the males) but whether all those male-female pairs are brother/sister may be tricky). I am currently debating whether I will have the 3 females in lane 1 sister to the 3 males in lane 2, or whether there should be a mix. I need to go over the Auer (2010) paper again to see if I can glean any more insight from it.
#################################################################################
As for the exact brother-sister pairs:
P. campbelli:
1. BB15.3M BB15.4F
2. BB77.2M BB77.1F
3. BB86.2M BB86.1F
4. no male yet BB87.1F ---> male BB87.6M
5. no male yet BB90.1F ---> male 77.3M
Average placenta weight of these individuals is: 0.11783g
Overall average of P. campbelli is: 0.11122g
quite close-this should be fine.
I need to sex-type more offspring from families BB86 and BB90. There are two more unknowns from 86 and one from 90. Hopefully they will be males, otherwise I'll have to use a brother of 15.1M, 77.2M or 86.2M which would work, but is not ideal.
#################################################################################
P. campbelli X P. sungorus:
1. BS70.3M BS70.4F
2. BS72.2M BS72.1F
3. BS73.3M BS73.1F
4. BS71.3M BS70.2F
5. BS11.1M BS73.2F
You'll notice that for pairs 4 and 5, the individuals are not siblings (what is worse - the females are sibs of pairs 1 and 3) There is nothing else I can do here. The only option would be to set up more crosses. I'll consider this, but I need to do this sequencing sooner rather than later and I don't think that this little bit of my perfectionism is worth the wait. I'll talk to J~ and see what he says.
Average placenta weight of these samples: 0.12916g
Overall average for these hybrids: 0.10948g
Not as close as before, but not awful.
#################################################################################
P. sungorus X P. campbelli:
1. SB20.2M SB20.6F
2. SB22.4M SB22.5F
3. SB25.5M SB25.3F
4. SB29.4M SB29.1F
5. SB20.8M SB24.2F
Pair 5 are not sibs, but unless I set up more crosses this is the best I can do.
Average of these samples: 0.47890g
Overall average for these hybrids: 0.39388g
Pretty good.
#################################################################################
P. sungorus:
1. SS82.1M SS82.2F
2. SS87.1M SS87.3F
3. SS88.1M SS88.3F
4. SS89.2M SS89.1F
5. SS91.1M no female yet ----> female SS91.4F
6. no male yet SS93.2F ----> don't use these
I will sex-type the other individuals in SS91 and SS93. If I can find a female from 91 or a male from 93 I will be set. Otherwise, I will use the ones shown above.
Average of these samples: 0.14113
Overall average of SS: 0.14757
Great.
#################################################################################
Now off to sex-type, updates soon...
Here's the results:
lane: gender
1 Ladder
2 BB87.5 male !!
3 BB87.6 male !!
4 BB90.3 female*
5 SS91.3 female !!
6 SS91.4 female !!
7 SS91.5 male
8 SS93.3 female
9 SS93.4 male !!
10 SS93.5 male !!
11 Pos (male)
12 Neg (female)
13 Neg (dH2O)
14 Ladder

!! these are the correct gender that I needed. I'll probably use BB87.6M and SS91.4F (and not SS932F and SS93.4M). Finally to round out the P. campbelli I will use BB77.3M.
*this sample seemed very degraded, won't use for RNAseq regardless, but it may be "female" due to failure of the PCR (rather than no Y chromosome) as there was very little DNA in the extraction...
#################################################################################
Auer, P. L. and R. W. Doerge. 2010. Statistical Design and Analysis of RNA Sequencing Data. Genetics 185:405–416.
DeVeale, B., D. van der Kooy and T. Babak. 2012. Critical Evaluation of Imprinted Gene Expression by RNA–Seq: A New Perspective. PLoS Genet 8:e1002600.
Gregg, C., J. Zhang, B. Weissbourd, S. Luo, G. P. Schroth, D. Haig and C. Dulac. 2010. High-Resolution Analysis of Parent-of-Origin Allelic Expression in the Mouse Brain. Science 329:643–648.
Gregg, C., J. Zhang, J. E. Butler, D. Haig and C. Dulac. 2010. Sex-Specific Parent-of-Origin Allelic Expression in the Mouse Brain. Science 329:682–685.
Proudhon, C. and D. Bourc'his. 2011. Identification and resolution of artifacts in the interpretation of imprinted gene expression. Briefings in Functional Genomics 9:374–384.
P. campbelli 5 female, 5 male
P. campbelli X P. sungorus 5 female, 5 male
P. sungorus X P. campbelli 5 female, 5 male
P. sungorus 5 female, 5 male
I will be able to sequence 20 samples per lane, meaning that I can't split it perfectly equally between the lanes. In order to avoid batch effects (Auer, 2010), I will use the following set up:
Lane 1:
P. campbelli 3 female, 2 male
P. campbelli X P. sungorus 3 female, 2 male
P. sungorus X P. campbelli 3 female, 2 male
P. sungorus 3 female, 2 male
Lane 2:
P. campbelli 2 female, 3 male
P. campbelli X P. sungorus 2 female, 3 male
P. sungorus X P. campbelli 2 female, 3 male
P. sungorus 2 female, 3 male
Finally, each of the 5 female and 5 male placentas will be brother-sister pairs, from 5 different litters (this is the ideal, I'll have to do some more sex-typing to see if I can actually make it work - stay tuned. I will definitely assure that the 5 females are from 5 different litters (and the same for the males) but whether all those male-female pairs are brother/sister may be tricky). I am currently debating whether I will have the 3 females in lane 1 sister to the 3 males in lane 2, or whether there should be a mix. I need to go over the Auer (2010) paper again to see if I can glean any more insight from it.
#################################################################################
As for the exact brother-sister pairs:
P. campbelli:
1. BB15.3M BB15.4F
2. BB77.2M BB77.1F
3. BB86.2M BB86.1F
4. no male yet BB87.1F ---> male BB87.6M
5. no male yet BB90.1F ---> male 77.3M
Average placenta weight of these individuals is: 0.11783g
Overall average of P. campbelli is: 0.11122g
quite close-this should be fine.
I need to sex-type more offspring from families BB86 and BB90. There are two more unknowns from 86 and one from 90. Hopefully they will be males, otherwise I'll have to use a brother of 15.1M, 77.2M or 86.2M which would work, but is not ideal.
#################################################################################
P. campbelli X P. sungorus:
1. BS70.3M BS70.4F
2. BS72.2M BS72.1F
3. BS73.3M BS73.1F
4. BS71.3M BS70.2F
5. BS11.1M BS73.2F
You'll notice that for pairs 4 and 5, the individuals are not siblings (what is worse - the females are sibs of pairs 1 and 3) There is nothing else I can do here. The only option would be to set up more crosses. I'll consider this, but I need to do this sequencing sooner rather than later and I don't think that this little bit of my perfectionism is worth the wait. I'll talk to J~ and see what he says.
Average placenta weight of these samples: 0.12916g
Overall average for these hybrids: 0.10948g
Not as close as before, but not awful.
#################################################################################
P. sungorus X P. campbelli:
1. SB20.2M SB20.6F
2. SB22.4M SB22.5F
3. SB25.5M SB25.3F
4. SB29.4M SB29.1F
5. SB20.8M SB24.2F
Pair 5 are not sibs, but unless I set up more crosses this is the best I can do.
Average of these samples: 0.47890g
Overall average for these hybrids: 0.39388g
Pretty good.
#################################################################################
P. sungorus:
1. SS82.1M SS82.2F
2. SS87.1M SS87.3F
3. SS88.1M SS88.3F
4. SS89.2M SS89.1F
5. SS91.1M no female yet ----> female SS91.4F
I will sex-type the other individuals in SS91 and SS93. If I can find a female from 91 or a male from 93 I will be set. Otherwise, I will use the ones shown above.
Average of these samples: 0.14113
Overall average of SS: 0.14757
Great.
#################################################################################
Now off to sex-type, updates soon...
Here's the results:
lane: gender
1 Ladder
2 BB87.5 male !!
3 BB87.6 male !!
4 BB90.3 female*
5 SS91.3 female !!
6 SS91.4 female !!
7 SS91.5 male
8 SS93.3 female
9 SS93.4 male !!
10 SS93.5 male !!
11 Pos (male)
12 Neg (female)
13 Neg (dH2O)
14 Ladder

!! these are the correct gender that I needed. I'll probably use BB87.6M and SS91.4F (and not SS932F and SS93.4M). Finally to round out the P. campbelli I will use BB77.3M.
*this sample seemed very degraded, won't use for RNAseq regardless, but it may be "female" due to failure of the PCR (rather than no Y chromosome) as there was very little DNA in the extraction...
#################################################################################
Auer, P. L. and R. W. Doerge. 2010. Statistical Design and Analysis of RNA Sequencing Data. Genetics 185:405–416.
DeVeale, B., D. van der Kooy and T. Babak. 2012. Critical Evaluation of Imprinted Gene Expression by RNA–Seq: A New Perspective. PLoS Genet 8:e1002600.
Gregg, C., J. Zhang, B. Weissbourd, S. Luo, G. P. Schroth, D. Haig and C. Dulac. 2010. High-Resolution Analysis of Parent-of-Origin Allelic Expression in the Mouse Brain. Science 329:643–648.
Gregg, C., J. Zhang, J. E. Butler, D. Haig and C. Dulac. 2010. Sex-Specific Parent-of-Origin Allelic Expression in the Mouse Brain. Science 329:682–685.
Proudhon, C. and D. Bourc'his. 2011. Identification and resolution of artifacts in the interpretation of imprinted gene expression. Briefings in Functional Genomics 9:374–384.
Friday, September 14, 2012
RNAseq and Overgrown hamsters, experimental setup
Yesterday I ordered all the reagents that I need to prep the libraries, I'm super excited about it especially since some arrived this morning. I'll be using a protocol designed by Sultan et al. (Sultan 2012) which maintains the strand specificity of the sequences. This is important because most imprinted transcripts lie in clusters in the genome (Edwards 2007; Reik 1997) which seem to be more gene-dense than the rest of the genome and can have overlapping transcripts on the + and - strands (Ideraabdullah, 2008). Maintaining strand-specificity will allow me to keep overlapping genes separate in my analysis.
The Sultan (2012) protocol to maintain strand specificity is pretty slick. Here's how it goes:
1. Extract total RNA (tRNA). I'll use an Omega miRNA kit for this and also a genomic DNA kit (in case I want to go back later and look at methylation patterns of the DNA). As placenta is a fairly heterogeneous tissue I need to use the entire sample to assure an even sampling of each of the three main layers. This means that I need to collect archival quality DNA and RNA as I won't be able to go back later if I decide I need something extra. I will grind it with liquid nitrogen and take some of the homogenate for the RNA kit, and some for the DNA kit.
2. Purify the tRNA. There are many types of RNAs in a tissue. I am only interested in messenger RNAs (mRNA) which will all have a poly-A tail. To purify the mRNA from tRNA I will use magnetic beads that have a poly-T oligo attached to them. These will bind to the mRNAs, magnetically bind to the plate, and keep my mRNA from being washed away with all the rest of the material. Then I will elute the mRNA away from beads and collect it for the next step.
3. Fragment the mRNA. mRNAs are much to long to sequence on the Illumina machine, so I need to break them up. I'll use a solution that Illumina provided to fragment the RNA.
4. First-strand synthesis. We do not have the technology to sequence RNA and so to get around this, we instead convert the RNA into DNA and then sequence that. DNA that came from RNA is called complement DNA (cDNA). As DNA is double stranded, this takes two steps, the first strand synthesis (with a reverse-transcriptase) and the second strand synthesis (with a regular polymerase).
5. Second Strand synthesis. This is the first step where the Sultan (2012) protocol differs from the standard Illumina Hiseq. Sultan (2012) calls for using dUTP instead of dTTP when forming the second DNA strand. This way I can later use an enzyme which chops up DNA on a "U" to cut away the second strand, leaving only the actual strand I am interested in - super clever.
6. End repair. After the mRNA-->cDNA conversion there are a lot of overhangs. Here I chop off all the extra so that each fragment has blunt ends.
7. Adenylate 3` end. In order to add on the adapters (necessary for the Illumina machine can sequence my cDNA library) I need an overhanging "A" on each 3` end. Here I add that "A".
8. Adapter ligation. Here I will barcode and add the adapters onto each of my sequences. I'll be splitting my 40 samples into 2 lanes of HiSeq, so I need 20 different barcodes. Here I will also have to make sure and not introduce batch effects into my design (Auer, 2010). I'll probably have another post entirely about this.
9. U-digestion. Here I will digest out the cDNA with "U"s in it so that I only have DNA oriented in the correct way. I will of course amplify this DNA, but it will cause the adapters to be wrong for the Illumina platform, so while they will be present, they won't be sequenced. Clever, clever, clever.
10. Enrich DNA fragment. Here I will PCR the library so that I have many copies of each molecule. This way there will be plenty for the Illumina machine to sequence.
11. Pool libraries. I will combine 20 of the samples into one lane and the other 20 for the other lane. Then send them off for sequencing.
So in short, I can keep almost the entire Illumina HiSeq kit as per usual, with a couple minor changes to maintain strand specificity.
As you may have noticed my in-text citations, it's because I recently bought the program papers, and am now testing it out in Chrome. It's nice by the way, especially for pages which I've recently started using. However, it looks like it won't format the bibliography directly from in-text citations in chrome, though it will format them properly if you go through and select each reference you want to work with.
Auer, P. L. and R. W. Doerge. 2010. Statistical Design and Analysis of RNA Sequencing Data. Genetics 185:405–416.
Ideraabdullah, F. Y., S. Vigneau and M. S. Bartolomei. 2008. Genomic imprinting mechanisms in mammals. Mutat. Res. 647:77–85.
Edwards, C. A. and A. C. Ferguson-Smith. 2007. Mechanisms regulating imprinted genes in clusters. Current Opinion in Cell Biology 19:281–289.
Reik, W. and E. R. Maher. 1997. Imprinting in clusters: lessons from Beckwith-Wiedemann syndrome. Trends in Genetics 13:330–334.
Sultan, M., S. Dökel, V. Amstislavskiy, D. Wuttig, H. Sültmann, H. Lehrach and M.-L. Yaspo. 2012. A simple strand-specific RNA-Seq library preparation protocol combining the Illumina TruSeq RNA and the dUTP methods. Biochemical and Biophysical Research Communications 422:643–646. Elsevier Inc.
The Sultan (2012) protocol to maintain strand specificity is pretty slick. Here's how it goes:
1. Extract total RNA (tRNA). I'll use an Omega miRNA kit for this and also a genomic DNA kit (in case I want to go back later and look at methylation patterns of the DNA). As placenta is a fairly heterogeneous tissue I need to use the entire sample to assure an even sampling of each of the three main layers. This means that I need to collect archival quality DNA and RNA as I won't be able to go back later if I decide I need something extra. I will grind it with liquid nitrogen and take some of the homogenate for the RNA kit, and some for the DNA kit.
2. Purify the tRNA. There are many types of RNAs in a tissue. I am only interested in messenger RNAs (mRNA) which will all have a poly-A tail. To purify the mRNA from tRNA I will use magnetic beads that have a poly-T oligo attached to them. These will bind to the mRNAs, magnetically bind to the plate, and keep my mRNA from being washed away with all the rest of the material. Then I will elute the mRNA away from beads and collect it for the next step.
3. Fragment the mRNA. mRNAs are much to long to sequence on the Illumina machine, so I need to break them up. I'll use a solution that Illumina provided to fragment the RNA.
4. First-strand synthesis. We do not have the technology to sequence RNA and so to get around this, we instead convert the RNA into DNA and then sequence that. DNA that came from RNA is called complement DNA (cDNA). As DNA is double stranded, this takes two steps, the first strand synthesis (with a reverse-transcriptase) and the second strand synthesis (with a regular polymerase).
5. Second Strand synthesis. This is the first step where the Sultan (2012) protocol differs from the standard Illumina Hiseq. Sultan (2012) calls for using dUTP instead of dTTP when forming the second DNA strand. This way I can later use an enzyme which chops up DNA on a "U" to cut away the second strand, leaving only the actual strand I am interested in - super clever.
6. End repair. After the mRNA-->cDNA conversion there are a lot of overhangs. Here I chop off all the extra so that each fragment has blunt ends.
7. Adenylate 3` end. In order to add on the adapters (necessary for the Illumina machine can sequence my cDNA library) I need an overhanging "A" on each 3` end. Here I add that "A".
8. Adapter ligation. Here I will barcode and add the adapters onto each of my sequences. I'll be splitting my 40 samples into 2 lanes of HiSeq, so I need 20 different barcodes. Here I will also have to make sure and not introduce batch effects into my design (Auer, 2010). I'll probably have another post entirely about this.
9. U-digestion. Here I will digest out the cDNA with "U"s in it so that I only have DNA oriented in the correct way. I will of course amplify this DNA, but it will cause the adapters to be wrong for the Illumina platform, so while they will be present, they won't be sequenced. Clever, clever, clever.
10. Enrich DNA fragment. Here I will PCR the library so that I have many copies of each molecule. This way there will be plenty for the Illumina machine to sequence.
11. Pool libraries. I will combine 20 of the samples into one lane and the other 20 for the other lane. Then send them off for sequencing.
So in short, I can keep almost the entire Illumina HiSeq kit as per usual, with a couple minor changes to maintain strand specificity.
As you may have noticed my in-text citations, it's because I recently bought the program papers, and am now testing it out in Chrome. It's nice by the way, especially for pages which I've recently started using. However, it looks like it won't format the bibliography directly from in-text citations in chrome, though it will format them properly if you go through and select each reference you want to work with.
Auer, P. L. and R. W. Doerge. 2010. Statistical Design and Analysis of RNA Sequencing Data. Genetics 185:405–416.
Ideraabdullah, F. Y., S. Vigneau and M. S. Bartolomei. 2008. Genomic imprinting mechanisms in mammals. Mutat. Res. 647:77–85.
Edwards, C. A. and A. C. Ferguson-Smith. 2007. Mechanisms regulating imprinted genes in clusters. Current Opinion in Cell Biology 19:281–289.
Reik, W. and E. R. Maher. 1997. Imprinting in clusters: lessons from Beckwith-Wiedemann syndrome. Trends in Genetics 13:330–334.
Sultan, M., S. Dökel, V. Amstislavskiy, D. Wuttig, H. Sültmann, H. Lehrach and M.-L. Yaspo. 2012. A simple strand-specific RNA-Seq library preparation protocol combining the Illumina TruSeq RNA and the dUTP methods. Biochemical and Biophysical Research Communications 422:643–646. Elsevier Inc.
Monday, August 13, 2012
Sex-typing pure species embryos and the RNAseq experiment
Now that I have the gDNA, I've set up the PCR to test for sex. The PCR appears to have worked well. So far for P. campbelli (lanes 1-22) I have 10 males from 3 crosses and 12 females from 6 crosses. From P. sungorus (lanes 23-40) I have 10 males from 5 crosses and 8 females from 5 crosses. This should work well for the RNAseq experiment as I want 5 of each gender of each species. However, I will extract a few more P. campbelli males as it would be nice to have 5 litters instead of 3 that way every individual represents a different replicate cross.
Below is the gel. Positive bands mean that individual is a male, whereas negative bands indicate that the PCR failed and I am interpreting that to be a female. Alternatively failed reactions could be males and failed for some other reason - it's hard to tell the difference between these two alternatives. I am assuming that there will be some non-specific amplification in the females, so a smear indicates that the reaction would have worked had there been a Y chromosome (rather than failed outright) and is thus an actual female, whereas a completely blank lane indicates a likely failed reaction. I'll only use "females" who showed some non-specific binding rather than the "females" where there is no product in the well at all (fortunately, all the "females" have a smear, none failed completely).
As I have alluded to it numerous times, here is the outline of the experiment and the motivation for the sex-typing:
I want to compare the imprinting (and more generally, the entire expression profile) in Phodopus hybrids. As the hybrids show drastic parent-of-origin dependent growth differences, there should be some pretty striking parent-of-origin dependent differences in gene regulation (likely a species-specific breakdown of imprinting). The general approach is to compare the profile of the reciprocal hybrids with each other and then to expression of the parents. The between-hybrid comparison can tell me about imprinting and whether it is disrupted in any specific manner as well as whether there are any transcriptome-wide changes in gene expression. The hybrid-parent comparison can tell me about overall level of expression and if it is in fact different between hybrids, then I can use the parent species as a control for "normal" levels.
We are unsure of whether there will be sex-specific expression differences though and to account for that - there are genes that are predicted to show differences between the sexes during development - I will use 5 of each sex from each cross type. This results in 40 samples, 5 biological replicates per genotype, which will hopefully give me enough power to ask the questions I'm interested in.
The sex-typing from above will help me choose which samples will be the ones that I prepare.
Below is the gel. Positive bands mean that individual is a male, whereas negative bands indicate that the PCR failed and I am interpreting that to be a female. Alternatively failed reactions could be males and failed for some other reason - it's hard to tell the difference between these two alternatives. I am assuming that there will be some non-specific amplification in the females, so a smear indicates that the reaction would have worked had there been a Y chromosome (rather than failed outright) and is thus an actual female, whereas a completely blank lane indicates a likely failed reaction. I'll only use "females" who showed some non-specific binding rather than the "females" where there is no product in the well at all (fortunately, all the "females" have a smear, none failed completely).
As I have alluded to it numerous times, here is the outline of the experiment and the motivation for the sex-typing:
I want to compare the imprinting (and more generally, the entire expression profile) in Phodopus hybrids. As the hybrids show drastic parent-of-origin dependent growth differences, there should be some pretty striking parent-of-origin dependent differences in gene regulation (likely a species-specific breakdown of imprinting). The general approach is to compare the profile of the reciprocal hybrids with each other and then to expression of the parents. The between-hybrid comparison can tell me about imprinting and whether it is disrupted in any specific manner as well as whether there are any transcriptome-wide changes in gene expression. The hybrid-parent comparison can tell me about overall level of expression and if it is in fact different between hybrids, then I can use the parent species as a control for "normal" levels.
We are unsure of whether there will be sex-specific expression differences though and to account for that - there are genes that are predicted to show differences between the sexes during development - I will use 5 of each sex from each cross type. This results in 40 samples, 5 biological replicates per genotype, which will hopefully give me enough power to ask the questions I'm interested in.
The sex-typing from above will help me choose which samples will be the ones that I prepare.
Thursday, August 9, 2012
gDNA extractions
The one thing that my RNAseq experiment (more about that later) needs is sex-specific data. However, I haven't been able to determine the sex of pure spp embryos as my sexing technique relies on heterozygosity between spp-specific fixed differences (thus it only works in hybrids). However, I have recently designed primers for SRY, the mammalian male-determining gene, and can now test the pure spp offspring.
This requires that I have gDNA from all my 120-some pure spp embryos. I dislike gDNA extraction because they never work quite like they should. We use a Machery-Nagel Nucleic acid and protein purification kit, which is a column based kit. This means that if you don't fully digest the tissue the column membrane will clog and turn an hour long protocol in to a six hour protocol.
I figured the reason it clogged is because when I add the protinase K I make a master mix of buffer and enzyme which sits for an hour or so as I collect the individual tissues. This may cause it to self-digest. So today I added the protinase K last to each sample after I added the tissue. I hoped that this would keep the enzyme's reactivity high. It appeared to work as all the digested tissues had little if any chunks of tissue left. However once I started the spin it was clear that something went wrong. Normally 20-30% clog, this time every single one was clogged.
The only thing to do then is spin for longer and faster. This works, but takes tons of time and can get really frustrating. This time was actually quicker than most though.
To get around this problem I have tried a number of things:
--varying the incubation period - overnight vs 3-5 hours
--assuring that the protinase K is not degraded
--pass the digested tissue through a syringe
--centrifuge the digested tissue and only use the supernate
Nothing alleviated the problem 100%. Perhaps a combination of fresh protinase, and the centrifuge would do...
Also it might be worth trying grinding the tissue on liquid Nitrogen...
#################
The other thing that I have done today is set up a PCR checking the sex of the hybrids using my SRY primers. I assayed their sex earlier with ZFX and this is a quick check to make sure that ZFX and SRY agree. I'll post that gel tomorrow once I run it out. In fact, I only did the first 94 samples of nearly 120 as that's the capacity of a PCR machine. I'll do the rest tomorrow.
I had a horrible time designing the SRY primers last summer, that's what led to the ZFX (which were also kind of a bitch to design). But last month J~ told me to take a week and see if I could get them working and that's all it took. I had to use every SRY sequence in genbank for cricetids, align them, build a tree, infer where my hamsters are and predict what the best sequences would be. Then, after a bunch of PCR optimizing I sequenced the messy product, and found redesigned primers based on actual hamster sequence.
Here are the primer sequences I ended up with:
>SRY5F
TGAATGCATTTATGGTGTGG
>SRY6R
AAGGTCTTCAGTCTCTGTGCTTC
the product is 166pb
Tm=60
Te=20sec
Cycles=35
Here is a temperature gradient from 54 to 60 showing the male band at around 166bps and the shorter primer dimers for the females. For some reason Blogger chopped off the labels I put on the ladder: the bottommost, quite faint band is 100bps, the next up is 200bps. My bands fall out right in between. The X-ed out parts are the same temp gradient but a different reverse primer that didn't work so well - it picked up non-specific stuff in the females and was just not nearly so robust. The four bands up top marked with "+"s are the same four DNA samples with a different gene, cytb, for positive controls.
Wednesday, August 8, 2012
Why am I writing a blog?
I dunno.
I went to a talk by Rosie Redfield at the Evolution meeting in Ontario last month where, surprise surprise, she told us all that we should start blogging. I doubt that's the real reason I'm doing this though.
It's probably more that she scared the shit out of me in her talk. I don't want to make the same mistakes that they did. Maybe this will help, maybe it won't. In all likelihood this blog will last the entire week, which I anticipate will total 2 posts and I'll forget all about it.
In any case, her talk was about the arsenic-based life paper that came out a while ago and all the fails that happened in order to get that paper published. She gives a great talk. She pointed out each step in the research that went wrong with great humor and the audience and myself laughed throughout. We laughed at the idiocy of those poor researchers who didn't do good science, we laughed at all the mistakes they made and how they should have known better.
And yet, I found myself thinking- even while laughing- yikes, I would have done that ... I would have fallen into the same trap ... I would have made that exact same mistake and never realized. Never realized that is, until Rosie herself ridiculed me to the audience at the next Evolution conference.
Honestly though, it wouldn't have been that bad for me, most of the mistakes she told us about I was right on board with - how on earth could someone do whatever-it-was and think it was ok? But then again, there was more than one mistake she described where it could have just as easily been me the one being roasted.
That's what scared me so bad - they were mistakes that I wouldn't even realize I was making.
So why blog?
I think it's because the biggest problem that happened with the arsenic research is that the lead author "fell in love with her hypothesis." What an easy trap to fall into. Rosie explained that in science there are the experiments you do when you think you are right, and the experiments you do when you honestly want to know if you are wrong.
I hope that by writing this out, by making it public, leaving no shadows to hide in, and no excuses to stand behind, I will come to terms with my loving hypotheses. I will do the experiments that will tell me I'm wrong.
And maybe someone will tell me if I'm making an unwitting mistake.
I went to a talk by Rosie Redfield at the Evolution meeting in Ontario last month where, surprise surprise, she told us all that we should start blogging. I doubt that's the real reason I'm doing this though.
It's probably more that she scared the shit out of me in her talk. I don't want to make the same mistakes that they did. Maybe this will help, maybe it won't. In all likelihood this blog will last the entire week, which I anticipate will total 2 posts and I'll forget all about it.
In any case, her talk was about the arsenic-based life paper that came out a while ago and all the fails that happened in order to get that paper published. She gives a great talk. She pointed out each step in the research that went wrong with great humor and the audience and myself laughed throughout. We laughed at the idiocy of those poor researchers who didn't do good science, we laughed at all the mistakes they made and how they should have known better.
And yet, I found myself thinking- even while laughing- yikes, I would have done that ... I would have fallen into the same trap ... I would have made that exact same mistake and never realized. Never realized that is, until Rosie herself ridiculed me to the audience at the next Evolution conference.
Honestly though, it wouldn't have been that bad for me, most of the mistakes she told us about I was right on board with - how on earth could someone do whatever-it-was and think it was ok? But then again, there was more than one mistake she described where it could have just as easily been me the one being roasted.
That's what scared me so bad - they were mistakes that I wouldn't even realize I was making.
So why blog?
I think it's because the biggest problem that happened with the arsenic research is that the lead author "fell in love with her hypothesis." What an easy trap to fall into. Rosie explained that in science there are the experiments you do when you think you are right, and the experiments you do when you honestly want to know if you are wrong.
I hope that by writing this out, by making it public, leaving no shadows to hide in, and no excuses to stand behind, I will come to terms with my loving hypotheses. I will do the experiments that will tell me I'm wrong.
And maybe someone will tell me if I'm making an unwitting mistake.
Subscribe to:
Posts (Atom)







.png)