gDNA extractions

The one thing that my RNAseq experiment (more about that later) needs is sex-specific data. However, I haven't been able to determine the sex of pure spp embryos as my sexing technique relies on heterozygosity between spp-specific fixed differences (thus it only works in hybrids). However, I have recently designed primers for SRY, the mammalian male-determining gene, and can now test the pure spp offspring.

This requires that I have gDNA from all my 120-some pure spp embryos. I dislike gDNA extraction because they never work quite like they should. We use a Machery-Nagel Nucleic acid and protein purification kit, which is a column based kit. This means that if you don't fully digest the tissue the column membrane will clog and turn an hour long protocol in to a six hour protocol. 

I figured the reason it clogged is because when I add the protinase K I make a master mix of buffer and enzyme which sits for an hour or so as I collect the individual tissues. This may cause it to self-digest. So today I added the protinase K last to each sample after I added the tissue. I hoped that this would keep the enzyme's reactivity high. It appeared to work as all the digested tissues had little if any chunks of tissue left. However once I started the spin it was clear that something went wrong. Normally 20-30% clog, this time every single one was clogged. 

The only thing to do then is spin for longer and faster. This works, but takes tons of time and can get really frustrating. This time was actually quicker than most though. 

To get around this problem I have tried a number of things:

--varying the incubation period - overnight vs 3-5 hours

--assuring that the protinase K is not degraded

--pass the digested tissue through a syringe

--centrifuge the digested tissue and only use the supernate

Nothing alleviated the problem 100%. Perhaps a combination of fresh protinase, and the centrifuge would do...

Also it might be worth trying grinding the tissue on liquid Nitrogen... 

#################

The other thing that I have done today is set up a PCR checking the sex of the hybrids using my SRY primers. I assayed their sex earlier with ZFX and this is a quick check to make sure that ZFX and SRY agree. I'll post that gel tomorrow once I run it out. In fact, I only did the first 94 samples of nearly 120 as that's the capacity of a PCR machine. I'll do the rest tomorrow. 

I had a horrible time designing the SRY primers last summer, that's what led to the ZFX (which were also kind of a bitch to design). But last month J~ told me to take a week and see if I could get them working and that's all it took. I had to use every SRY sequence in genbank for cricetids, align them, build a tree, infer where my hamsters are and predict what the best sequences would be. Then, after a bunch of PCR optimizing I sequenced the messy product, and found redesigned primers based on actual hamster sequence. 

Here are the primer sequences I ended up with: 

>SRY5F

TGAATGCATTTATGGTGTGG

>SRY6R

AAGGTCTTCAGTCTCTGTGCTTC

the product is 166pb

Tm=60

Te=20sec

Cycles=35

Here is a temperature gradient from 54 to 60 showing the male band at around 166bps and the shorter primer dimers for the females. For some reason Blogger chopped off the labels I put on the ladder: the bottommost, quite faint band is 100bps, the next up is 200bps. My bands fall out right in between. The X-ed out parts are the same temp gradient but a different reverse primer that didn't work so well - it picked up non-specific stuff in the females and was just not nearly so robust. The four bands up top marked with "+"s are the same four DNA samples with a different gene, cytb, for positive controls.